cdna constructs encoding the human nav1.8 Search Results


95
Alomone Labs anti na v 1 8
Anti Na V 1 8, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Anti-NaV1%2E8+(SCN10A)+Antibody/pmc06554007-79-19-40
Average 95 stars, based on 1 article reviews
anti na v 1 8 - by Bioz Stars, 2026-09
95/100 stars
  Buy from Supplier

91
OriGene human nav1 8 cdna
Human Nav1 8 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Nav1%2E8+(SCN10A)+(NM_006514)+Human+Tagged+ORF+Clone/pm37695396-36-6-14
Average 91 stars, based on 1 article reviews
human nav1 8 cdna - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
Addgene inc pn3 sp1fl
Pn3 Sp1fl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pN3-Sp1FL+(Plasmid+%2324543)/pmc03952860-212-88-107
Average 93 stars, based on 1 article reviews
pn3 sp1fl - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

94
OriGene scn10a
Scn10a, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Nav1%2E8+(SCN10A)+(NM_006514)+Human+Untagged+Clone/pmc13125304-24-51-66
Average 94 stars, based on 1 article reviews
scn10a - by Bioz Stars, 2026-09
94/100 stars
  Buy from Supplier

90
SignaGen pn3-hiv-2-gag plasmid
Pn3 Hiv 2 Gag Plasmid, supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pn3+hiv+2+gag+plasmid/pmc11057910-421-2-20
Average 90 stars, based on 1 article reviews
pn3-hiv-2-gag plasmid - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
Chantest Inc human nav1.8
Human Nav1.8, supplied by Chantest Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/cho+cells+stably+expressing+human+na+v+1+8/pm32524995-67-33-35
Average 90 stars, based on 1 article reviews
human nav1.8 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene mouse na v 1 8
Mouse Na V 1 8, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/SOX10+(BC002824)+Human+Untagged+Clone/pmc06264633-619-3-11
Average 90 stars, based on 1 article reviews
mouse na v 1 8 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
OriGene tggcagatgacctggaagaacc
Tggcagatgacctggaagaacc, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Nav1%2E8+(SCN10A)+Human+qPCR+Primer+Pair/pm30378291-59-14-18
Average 90 stars, based on 1 article reviews
tggcagatgacctggaagaacc - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

90
GenScript corporation pcdna3.1-human nav1.8 (plasmid)
Pcdna3.1 Human Nav1.8 (Plasmid), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pcdna3+1/pmc09071269-23-4-8
Average 90 stars, based on 1 article reviews
pcdna3.1-human nav1.8 (plasmid) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

89
Thermo Fisher gene exp scn10a rn00568393 m1
Gene Exp Scn10a Rn00568393 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Gene+Exp%2E+Scn10a%2C+Rn00568393_m1/pmc11984575-85-13-40
Average 89 stars, based on 1 article reviews
gene exp scn10a rn00568393 m1 - by Bioz Stars, 2026-09
89/100 stars
  Buy from Supplier

90
SignaGen codonoptimized htlv-1 gag expression construct derivative with a c-terminal ha epitope tag (pn3-htlv-1-gag-ha)
Codonoptimized Htlv 1 Gag Expression Construct Derivative With A C Terminal Ha Epitope Tag (Pn3 Htlv 1 Gag Ha), supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/peyfp+n3+htlv+1+gag+construct/10__1074_slash_jbc__ra118__005531-372-16-30
Average 90 stars, based on 1 article reviews
codonoptimized htlv-1 gag expression construct derivative with a c-terminal ha epitope tag (pn3-htlv-1-gag-ha) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results