95
|
Alomone Labs
anti na v 1 8 Anti Na V 1 8, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Anti-NaV1%2E8+(SCN10A)+Antibody/pmc06554007-79-19-40 Average 95 stars, based on 1 article reviews
anti na v 1 8 - by Bioz Stars,
2026-09
95/100 stars
|
Buy from Supplier |
91
|
OriGene
human nav1 8 cdna Human Nav1 8 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Nav1%2E8+(SCN10A)+(NM_006514)+Human+Tagged+ORF+Clone/pm37695396-36-6-14 Average 91 stars, based on 1 article reviews
human nav1 8 cdna - by Bioz Stars,
2026-09
91/100 stars
|
Buy from Supplier |
93
|
Addgene inc
pn3 sp1fl Pn3 Sp1fl, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pN3-Sp1FL+(Plasmid+%2324543)/pmc03952860-212-88-107 Average 93 stars, based on 1 article reviews
pn3 sp1fl - by Bioz Stars,
2026-09
93/100 stars
|
Buy from Supplier |
94
|
OriGene
scn10a Scn10a, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Nav1%2E8+(SCN10A)+(NM_006514)+Human+Untagged+Clone/pmc13125304-24-51-66 Average 94 stars, based on 1 article reviews
scn10a - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
90
|
SignaGen
pn3-hiv-2-gag plasmid Pn3 Hiv 2 Gag Plasmid, supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pn3+hiv+2+gag+plasmid/pmc11057910-421-2-20 Average 90 stars, based on 1 article reviews
pn3-hiv-2-gag plasmid - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
Chantest Inc
human nav1.8 Human Nav1.8, supplied by Chantest Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/cho+cells+stably+expressing+human+na+v+1+8/pm32524995-67-33-35 Average 90 stars, based on 1 article reviews
human nav1.8 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
OriGene
mouse na v 1 8 Mouse Na V 1 8, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/SOX10+(BC002824)+Human+Untagged+Clone/pmc06264633-619-3-11 Average 90 stars, based on 1 article reviews
mouse na v 1 8 - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
OriGene
tggcagatgacctggaagaacc Tggcagatgacctggaagaacc, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Nav1%2E8+(SCN10A)+Human+qPCR+Primer+Pair/pm30378291-59-14-18 Average 90 stars, based on 1 article reviews
tggcagatgacctggaagaacc - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
90
|
GenScript corporation
pcdna3.1-human nav1.8 (plasmid) Pcdna3.1 Human Nav1.8 (Plasmid), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/pcdna3+1/pmc09071269-23-4-8 Average 90 stars, based on 1 article reviews
pcdna3.1-human nav1.8 (plasmid) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |
89
|
Thermo Fisher
gene exp scn10a rn00568393 m1 Gene Exp Scn10a Rn00568393 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/Gene+Exp%2E+Scn10a%2C+Rn00568393_m1/pmc11984575-85-13-40 Average 89 stars, based on 1 article reviews
gene exp scn10a rn00568393 m1 - by Bioz Stars,
2026-09
89/100 stars
|
Buy from Supplier |
90
|
SignaGen
codonoptimized htlv-1 gag expression construct derivative with a c-terminal ha epitope tag (pn3-htlv-1-gag-ha) Codonoptimized Htlv 1 Gag Expression Construct Derivative With A C Terminal Ha Epitope Tag (Pn3 Htlv 1 Gag Ha), supplied by SignaGen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/cdna+constructs+encoding+the+human+nav1%2E8/peyfp+n3+htlv+1+gag+construct/10__1074_slash_jbc__ra118__005531-372-16-30 Average 90 stars, based on 1 article reviews
codonoptimized htlv-1 gag expression construct derivative with a c-terminal ha epitope tag (pn3-htlv-1-gag-ha) - by Bioz Stars,
2026-09
90/100 stars
|
Buy from Supplier |